How Companies Can Deliver Convenient Experiences Through Technology And Modularity

How Companies Can Deliver Convenient Experiences Through Technology And Modularity

John Lamb is the Director of Marketing at Elo .

Consumer-oriented technologies have developed rapidly in recent years. Now, point-of-sale innovation has outgrown the testing phase and has become an almost unspoken requirement for companies hoping to provide convenience and stay competitive. The rapid development of technological innovation has challenged the IT systems, equipment requirements and practices of retail and hospitality businesses. But the result is a modular approach to developing systems that, by their very nature, adapt to the challenges of the inevitable future.

As the Marketing Director of a company that offers embedded modular technologies for retail, self-checkout, point of sale, and other applications including touch screens, I've seen the benefit of using flexible embedded solutions in that they allow companies to deploy and redeploy the technology they do. . Transforms in light of changing market and business conditions.

Innovation and rapid development are one of the keys to expanding and improving your business, even during an economic downturn and a pandemic. He often uses technology that aligns with choice and convenience and provides that momentum.

The younger generation is at the forefront of changing consumption patterns. In my experience, they don't want to stand in long lines when ordering food and are used to knowing when their order is ready via push notifications. Companies that do not offer these benefits may fall behind.

Endless innovation paths

Innovation continues to accelerate and the strategic use of technology can be the difference between winners and losers. I think this strategic use calls for more modularization and moving towards the container – bringing together everything you need to run the software as you go from one place to another – and moving to the cloud.

For retailers, a computer or touch screen is an essential requirement. But the real modularity comes from the ability to add components such as scanners, cameras, or different payment devices so that the same screen can be customized or reconfigured and moved across multiple touchpoints.

Using innovative technologies based on the needs and desires of your customers opens up opportunities for you to improve the consumer experience. One use case is offering a complete mobile app that combines a rewards or loyalty program, personalized coupons sent via notifications, and the ability to speed up in-store interactions through geo-fencing and touch functionality. Offerings like this can show your customers that you are willing and able to go the extra mile to provide tailored solutions to meet their needs.

Additional peripherals are part of a standalone business solution that enables next generation customers. Companies must challenge their key partners to put together an innovative team that will ensure that the consumer experience is taken to the next level.

Use standard building blocks

The ability to transfer technologies or components of a product, known as design modularity, can help speed up innovation. This can help organizations secure their solutions, allowing them to quickly move on to other use cases and applications.

Each element added to the basic technology is like Lego bricks. Ambitious companies can take all of these elements and create any kind of interactive solution in industries such as retail and hospitality. In the hospitality industry, they can automate personal reservations so employees can take on more strategic roles in customer service. Later, they can deploy the same screen as a dashboard, kitchen control system, or timer operating system.

Modular technology is less exotic than it may seem, and most companies and consumers use it all the time without even realizing it. Modular furniture, such as Lovesack sofas, allows users to design and reconfigure furniture at any time. Modular smartwatches allow you to change the watch band or add more features.

For legacy businesses like food trucks, the modular technology could take the form of kiosks that allow customers to order food and receive text messages when food is available for pickup. The common denominator here is convenience. No matter your industry, your company likely has a process or product that can be improved to provide a smoother experience for your customers.

Think of the customer first

Once a festival food truck offers that level of convenience, it becomes the new norm. We've already seen this phenomenon in the retail and hospitality industries. Those who develop successful systems can benefit even as costs increase, while companies that don't value convenience are more likely to fail.

Many companies make the mistake of prioritizing new technologies before understanding changing consumer expectations. By getting to know your customers first, you can choose the right building blocks to anticipate their needs before they speak. Companies can adapt by constantly adding new items as the market evolves.

Steve Jobs once cited the world's first mini laser printer as an example of a product that Apple hopes to sell successfully. “You have to start with the customer experience and go back to the technology,” he said of a principle relevant today. "You can't start with a technology and try to figure out where you're trying to sell it."

Business is ready for the future

No more arguments: Many consumers will turn to a competitor if their expectations are not met. Optimization ensures that the creativity, blood and sweat that people put into their business prepares them for what the future may bring.

Companies that want to introduce new technologies and start the innovation process must first focus on those aspects of the business that customers are dissatisfied with. Evaluate customers' pain points, brainstorm how to solve those problems, and then consider finding technologies that will ultimately improve the customer experience.

As explained in this Harvard Business Review (Paywall) article, the ability to quickly change in a rapidly changing market environment is critical to a future business. A game for survival and growth. There are already winners and losers in this space, and Smart Followers are working with their innovation teams to deliver a new, streamlined global experience. In my view, delivering benefits is no longer a value-add – it has become a competitive necessity.


The Forbes Communications Council is a closed community of leaders in successful PR, media strategy, creative and advertising agencies. What am I entitled to?


Psychological tricks to make people say yes.

25 thoughts on “How Companies Can Deliver Convenient Experiences Through Technology And Modularity

  1. The bone dragon whined what should a healthy blood pressure be silently and fled everywhere, However, under the combined force of the four unicorns, the flame chariot far surpassed the huge keel in terms of speed and flexibility 100mg lasix The production of 16 mg active P450 per liter of culture was achieved by mutating the sequence 5 from ATGTGGCTGCTCCTGGCTGTCTTT to ATGGCTCTGTTATTAGCAGTTTTT or in terms of amino acids from MWLLLAVF to MALLLAVF

  2. Some are medicines that help people when doctors prescribe. Learn about the side effects, dosages, and interactions.
    ivermectin humans
    Get warning information here. All trends of medicament.

Leave a Comment

error: Content is protected !!